Maths ; Physique-Chimie ; SVT
 
AccueilPortailFAQRechercherS'enregistrerMembresGroupesConnexion

Partagez | 
 

 dm SVT sur l'hémoglobine et myoglobine 2nd

Voir le sujet précédent Voir le sujet suivant Aller en bas 
AuteurMessage
etudiante_49
micro posteur
micro posteur


Nombre de messages : 24
Classe/Métier (si enseignant, précisez) : seconde
Date d'inscription : 13/12/2008

MessageSujet: dm SVT sur l'hémoglobine et myoglobine 2nd   Dim 14 Déc - 3:56

bonjour,

j'ai un dm à rendre pour mardi et je n'y arrive pas si quelqu'un peut m'aider

voilà le sujet:

séquences des bases d'un brin de la molécule d'ADN:
1- GTGCACCTGACTCCTGAGGAG
2- GTGCATCTGACTCCTGAGGAG
3- GTGCACCTGACTCCTAAGGAG

conséquences sur l'organisme: (les conséquences sont indiqués sont indiquées lorsque les séquences sont en 2 exemplaires identiques sur les 2 chromosomes de la paire n°11)
1- hémoglobine normale. pas d'anémie.
2- hémoglobine normale. oas d'anémie.
3- hémoglobine légèrement différente. anémie.

séquence des 21 premières bases de l'un des brin d'ADN constituant le gène responsable de la fabrication d'une partie de l'hémoglobine (molécule permettant le transport du O2 dans le sang)

questions:

1- montrez qu'une modification dans la séquence des bases peut entraîner un modification de l'information génétique.

2- 2 séquences différentes peuvent-elles avoir la même conséquence au niveau de l'organisme?

3- les 21 premières bases du gène de la myoglobine sont : GGGCTCAGCGACGGGGAATGG. quels arguments permettent d'affirmer que la fabrication de la myoglobine dépend d'un gène différent du gène de l'hémoglobine?


mes réponses:

1- on peut voir que dans la modification d'une lettre suffit pour qu'il y ait une anémie car dans la première séquence et la troisième séquence il y a une lettre changée qui est en position 16.

2- oui, car pour les 2 premières séquences qui sont différentes elles ont la même conséquence. l'hémoglobine est normale, il n'ya pas d'anémie.

3- je ne sais pas du tout! confused

si vous pouvez m'aider
je vous remercie d'avance!
a très bientôt Smile
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
yoda64
Biomodé
Biomodé


Masculin
Nombre de messages : 125
Age : 44
Classe/Métier (si enseignant, précisez) : professeur SVT
Localisation : cote basque
Date d'inscription : 29/09/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Dim 14 Déc - 11:11

etudiante_49
Citation :
1- on peut voir que dans la modification d'une lettre suffit pour qu'il y ait une anémie car dans la première séquence et la troisième séquence il y a une lettre changée qui est en position 16.

il faut que tu"vois" ce que représente les lettres, ce ne sont pas de simples lettres mais des molécules, dis plutot qu'il suffit de changer "l'une des bases" ...
il s'agit d'une mutation par substitution, une base (une guanine "G") a été substituée par une adénine ( "A")

Citation :
2- oui, car pour les 2 premières séquences qui sont différentes elles ont la même conséquence. l'hémoglobine est normale, il n'ya pas d'anémie.

oui Wink

Citation :
les 21 premières bases du gène de la myoglobine sont : GGGCTCAGCGACGGGGAATGG. quels arguments permettent d'affirmer que la fabrication de la myoglobine dépend d'un gène différent du gène de l'hémoglobine?

je ne sais pas du tout!

j'avoue que ce qui me gène est le "quelS argumentS", je ne vois pas trop où veut en venir ton prof, par contre il y a un argument majeur c'est tout simplement de comparer les séquences.
si, comme c'est le cas entre les 3 versions différentes de l'hémoglobine (ce sont donc des allèles, revoir programme 3ème ) tu n'as qu'une ou deux, au maximun, de différence, alors c'est le même gène qui a muté...
mais qd tu compares la séquence nucléotidiques pour l'hémoglobine de celle pour la myoglobine tu notes un grand nombre de différences, ce sont donc deux gènes bien différents.... Wink
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://biologieaucollege.forumactif.org/
etudiante_49
micro posteur
micro posteur


Nombre de messages : 24
Classe/Métier (si enseignant, précisez) : seconde
Date d'inscription : 13/12/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Dim 14 Déc - 23:09

merci

donc pour la réponse 1, je répond on peut voir que la modification d'une des bases suffit pour qu'il y ait une anémie car dans la première séquence et la troisième séquence il y a une lettre changée qui est en position 16. il s'agit d'une mutation par substitution, une base, une guanine ("G") a été substituée par une adénine ( "A")

Smile
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
yoda64
Biomodé
Biomodé


Masculin
Nombre de messages : 125
Age : 44
Classe/Métier (si enseignant, précisez) : professeur SVT
Localisation : cote basque
Date d'inscription : 29/09/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Lun 15 Déc - 9:52

oui c'est cela Wink
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://biologieaucollege.forumactif.org/
yoda64
Biomodé
Biomodé


Masculin
Nombre de messages : 125
Age : 44
Classe/Métier (si enseignant, précisez) : professeur SVT
Localisation : cote basque
Date d'inscription : 29/09/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Lun 15 Déc - 9:58

pour la troisième question, tiens nous au courant, je serai curieux de savoir ce qu'attend ton prof comme différents arguments (puisqu'il a mis arguments au pluriel), cela m'intrigue et j'ai horreur de rester dans le flou !!! lol!

ensuite il n'est jamais évident de répondre comme ceci sans connaitre l'avancée de ton cours... Wink
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://biologieaucollege.forumactif.org/
etudiante_49
micro posteur
micro posteur


Nombre de messages : 24
Classe/Métier (si enseignant, précisez) : seconde
Date d'inscription : 13/12/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Lun 15 Déc - 11:42

oui d'accord! je te le dirai dès que j'aurai le corigé, c'est vrai ce n'est pas évident Smile
en tout cas merci beaucoup
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
etudiante_49
micro posteur
micro posteur


Nombre de messages : 24
Classe/Métier (si enseignant, précisez) : seconde
Date d'inscription : 13/12/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Mar 20 Jan - 23:58

bonjour, voilà j'ai enfin le corigé du dm
pour la troisième question, notre prof attendais: sur les 21 bases que comportent les séquences, 14 sont différentes entre la séquence 1 de l'hémoglobine et celle de la myoglobine. ce nombre trop important pour qu'il s'agisse du même gène avec deux allèles.

voilà en fait, je pense que cela devait être une erreur de frappe puisqu'il y avait qu'un seul argument

et merci beaucoup! ^^
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
yoda64
Biomodé
Biomodé


Masculin
Nombre de messages : 125
Age : 44
Classe/Métier (si enseignant, précisez) : professeur SVT
Localisation : cote basque
Date d'inscription : 29/09/2008

MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Sam 31 Jan - 9:52

merci à toi d'être revenue nous confirmer le corrigé et courage pour la suite Wink
Revenir en haut Aller en bas
Voir le profil de l'utilisateur http://biologieaucollege.forumactif.org/
Contenu sponsorisé




MessageSujet: Re: dm SVT sur l'hémoglobine et myoglobine 2nd   Aujourd'hui à 19:20

Revenir en haut Aller en bas
 
dm SVT sur l'hémoglobine et myoglobine 2nd
Voir le sujet précédent Voir le sujet suivant Revenir en haut 
Page 1 sur 1
 Sujets similaires
-
» synthèse hémoglobine
» Cerise
» Les dons de sang
» Le Dormeur du Val et MC Solaar
» Dossier sur le Saint Suaire

Permission de ce forum:Vous ne pouvez pas répondre aux sujets dans ce forum
Forum Des Maths :: Coin Biologie... :: La SVT pour tout niveau-
Sauter vers: